Transcript: Mouse XM_017321624.1

PREDICTED: Mus musculus diacylglycerol kinase, iota (Dgki), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dgki (320127)
Length:
13445
CDS:
112..3450

Additional Resources:

NCBI RefSeq record:
XM_017321624.1
NBCI Gene record:
Dgki (320127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221696 GATCTATCCAAACACGTCAAA pLKO.1 1954 CDS 100% 4.950 6.930 N Dgki n/a
2 TRCN0000221695 CGTATGTACATAGACCGTCTA pLKO.1 2584 CDS 100% 4.050 5.670 N Dgki n/a
3 TRCN0000221693 GCTACATTGAAGTCATTGGAT pLKO.1 2129 CDS 100% 3.000 4.200 N Dgki n/a
4 TRCN0000360962 AGCTAATGGAATCCATATTTG pLKO_005 3530 3UTR 100% 13.200 9.240 N Dgki n/a
5 TRCN0000360969 CTGTAACCACCCATCGATTTA pLKO_005 3830 3UTR 100% 13.200 9.240 N Dgki n/a
6 TRCN0000360965 TGCTTCATGCTGCATCATATT pLKO_005 991 CDS 100% 13.200 9.240 N Dgki n/a
7 TRCN0000360964 TTTGATGCTCACGTCACATTG pLKO_005 1822 CDS 100% 10.800 7.560 N Dgki n/a
8 TRCN0000025389 CCTGCTTCATGCTGCATCATA pLKO.1 989 CDS 100% 5.625 3.938 N LOC381757 n/a
9 TRCN0000025391 TGGATCATTAAGGTGAAGAAA pLKO.1 1063 CDS 100% 5.625 3.938 N LOC381757 n/a
10 TRCN0000221692 CCTCTGGGTATTCTAGTTGTT pLKO.1 2536 CDS 100% 4.950 3.465 N Dgki n/a
11 TRCN0000025392 GCCGGACAGAAAGAGAAGGAA pLKO.1 421 CDS 100% 3.000 2.100 N LOC381757 n/a
12 TRCN0000025393 GAAGCAGGTCTCTTACAGGAA pLKO.1 480 CDS 100% 2.640 1.848 N LOC381757 n/a
13 TRCN0000006091 CCAGATATTGTGCTGGCACAA pLKO.1 2051 CDS 100% 0.405 0.284 N DGKI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.