Transcript: Mouse XM_017321650.1

PREDICTED: Mus musculus transportin 3 (Tnpo3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnpo3 (320938)
Length:
3935
CDS:
423..2996

Additional Resources:

NCBI RefSeq record:
XM_017321650.1
NBCI Gene record:
Tnpo3 (320938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321650.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101966 GCGTACAAACATTGGTAGAAA pLKO.1 598 CDS 100% 5.625 7.875 N Tnpo3 n/a
2 TRCN0000101968 CCTCAGTATGAGGTAGTAGAA pLKO.1 1224 CDS 100% 4.950 6.930 N Tnpo3 n/a
3 TRCN0000101969 CCGAAGAAGTACATAGTCGTT pLKO.1 676 CDS 100% 2.640 3.696 N Tnpo3 n/a
4 TRCN0000101965 CCTGGTGAACTTCTTTCTAAA pLKO.1 3269 3UTR 100% 13.200 9.240 N Tnpo3 n/a
5 TRCN0000101967 CCAATCTTACAGTGGGCCATT pLKO.1 2547 CDS 100% 4.050 2.835 N Tnpo3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321650.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.