Transcript: Mouse XM_017321662.1

PREDICTED: Mus musculus kielin/chordin-like protein (Kcp), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcp (333088)
Length:
4583
CDS:
4..4374

Additional Resources:

NCBI RefSeq record:
XM_017321662.1
NBCI Gene record:
Kcp (333088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098202 CTGCCTGTGATAGCTGTGATT pLKO.1 1931 CDS 100% 4.950 3.465 N Kcp n/a
2 TRCN0000098201 GCTGGTGAAGTATCCTGTGAA pLKO.1 796 CDS 100% 4.950 3.465 N Kcp n/a
3 TRCN0000098203 GTATGCTAATGGGCAGAACTT pLKO.1 1077 CDS 100% 4.950 3.465 N Kcp n/a
4 TRCN0000098200 GCTGAGTTAAGAATACCCATA pLKO.1 4424 3UTR 100% 4.050 2.835 N Kcp n/a
5 TRCN0000098204 GTGTGAAGTGTGCATCTGCAA pLKO.1 2709 CDS 100% 2.640 1.848 N Kcp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.