Transcript: Mouse XM_017321755.1

PREDICTED: Mus musculus aprataxin and PNKP like factor (Aplf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aplf (72103)
Length:
3317
CDS:
249..1748

Additional Resources:

NCBI RefSeq record:
XM_017321755.1
NBCI Gene record:
Aplf (72103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250397 CATTCTTGAAGTGGTTGATAG pLKO_005 377 CDS 100% 10.800 15.120 N Aplf n/a
2 TRCN0000250398 GTGGTTAACTTACCTGATAAG pLKO_005 645 CDS 100% 10.800 15.120 N Aplf n/a
3 TRCN0000201047 CCCAGCACAAGATGGAATATA pLKO.1 1528 CDS 100% 15.000 10.500 N Aplf n/a
4 TRCN0000250399 GAATCCTGGGAAGACTATTAA pLKO_005 2203 3UTR 100% 15.000 10.500 N Aplf n/a
5 TRCN0000216580 GGATATTGTGAAGACAAATAA pLKO.1 1103 CDS 100% 15.000 10.500 N Aplf n/a
6 TRCN0000250395 GGATATTGTGAAGACAAATAA pLKO_005 1103 CDS 100% 15.000 10.500 N Aplf n/a
7 TRCN0000250396 TGCAAGGAAGCCCTGAAATAA pLKO_005 685 CDS 100% 15.000 10.500 N Aplf n/a
8 TRCN0000215334 CTTGATGAAGATGATATATTG pLKO.1 603 CDS 100% 13.200 9.240 N Aplf n/a
9 TRCN0000200905 CCATCAGTGAAAGCAGGTAAA pLKO.1 1909 3UTR 100% 10.800 7.560 N Aplf n/a
10 TRCN0000087098 CCTCATATAAGACACAAACAT pLKO.1 2816 3UTR 100% 5.625 2.813 Y LOC433285 n/a
11 TRCN0000087578 GAATCCAATTTGGTGGAGATT pLKO.1 2871 3UTR 100% 4.950 2.475 Y LOC434071 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.