Transcript: Mouse XM_017321764.1

PREDICTED: Mus musculus RAD9-HUS1-RAD1 interacting nuclear orphan 1 (Rhno1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rhno1 (72440)
Length:
1558
CDS:
199..906

Additional Resources:

NCBI RefSeq record:
XM_017321764.1
NBCI Gene record:
Rhno1 (72440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184171 CGCAAGTCATCCTGGTTTGAA pLKO.1 955 3UTR 100% 5.625 7.875 N Rhno1 n/a
2 TRCN0000179640 GCAAGTCATCCTGGTTTGAAA pLKO.1 956 3UTR 100% 5.625 7.875 N Rhno1 n/a
3 TRCN0000184465 GCACCAGGAACCGTTGAATTT pLKO.1 1051 3UTR 100% 13.200 10.560 N Rhno1 n/a
4 TRCN0000215797 CCAAACACCACTATGAATCTT pLKO.1 272 CDS 100% 5.625 3.938 N Rhno1 n/a
5 TRCN0000184717 CCTGCAAGTTTCCACGTCTAA pLKO.1 458 CDS 100% 4.950 3.465 N Rhno1 n/a
6 TRCN0000184464 GAAGCCAGTTCCTTGTGAAGA pLKO.1 881 CDS 100% 4.950 3.465 N Rhno1 n/a
7 TRCN0000184087 CCACGTCTAACCTTTGAGAGT pLKO.1 469 CDS 100% 2.640 1.848 N Rhno1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.