Transcript: Mouse XM_017321841.1

PREDICTED: Mus musculus N-acetyltransferase 8 (GCN5-related) family member 3 (Nat8f3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nat8f3 (93674)
Length:
1198
CDS:
295..978

Additional Resources:

NCBI RefSeq record:
XM_017321841.1
NBCI Gene record:
Nat8f3 (93674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114604 ACTTCACCTCTCTGTGTCATT pLKO.1 711 CDS 100% 4.950 2.475 Y Nat8f3 n/a
2 TRCN0000114601 CTGTCCATCCTTACCCTCTTT pLKO.1 487 CDS 100% 4.950 2.475 Y Nat8f3 n/a
3 TRCN0000114605 CTGGTTCTTCTGTCCATCCTT pLKO.1 478 CDS 100% 3.000 1.500 Y Nat8f3 n/a
4 TRCN0000114602 AGTTGTCCTTTCCACCAGCAT pLKO.1 810 CDS 100% 2.640 1.320 Y Nat8f3 n/a
5 TRCN0000114603 CCACAGGAGTGTGGTGGATTT pLKO.1 333 CDS 100% 1.080 0.540 Y Nat8f3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.