Transcript: Mouse XM_017321875.1

PREDICTED: Mus musculus histone H3.3-like (LOC105242736), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC105242736 (105242736)
Length:
656
CDS:
1..429

Additional Resources:

NCBI RefSeq record:
XM_017321875.1
NBCI Gene record:
LOC105242736 (105242736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012023 CGTTCATTTGTGTGTGAATTT pLKO.1 600 3UTR 100% 13.200 6.600 Y H3f3a n/a
2 TRCN0000420184 GTAGTTCTGAATGTTAGATAT pLKO_005 495 3UTR 100% 13.200 6.600 Y H3f3a n/a
3 TRCN0000271908 TCAGCGTCTGGTGCGAGAAAT pLKO_005 222 CDS 100% 13.200 6.600 Y Gm12657 n/a
4 TRCN0000413871 GCAAATCCACCGGTGGTAAAG pLKO_005 44 CDS 100% 10.800 5.400 Y H3f3a n/a
5 TRCN0000271941 TATCCATGCCAAACGTGTAAC pLKO_005 354 CDS 100% 10.800 5.400 Y Gm12657 n/a
6 TRCN0000012027 CCATGCCAAACGTGTAACAAT pLKO.1 357 CDS 100% 5.625 2.813 Y H3f3a n/a
7 TRCN0000012026 GCGAGAAATTGCTCAGGACTT pLKO.1 234 CDS 100% 4.050 2.025 Y H3f3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.