Transcript: Mouse XM_017321884.1

PREDICTED: Mus musculus RIKEN cDNA C130026I21 gene (C130026I21Rik), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
C130026I21Rik (620078)
Length:
1993
CDS:
197..1114

Additional Resources:

NCBI RefSeq record:
XM_017321884.1
NBCI Gene record:
C130026I21Rik (620078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225826 ACGTCCGAACTGGTCAAATTC pLKO_005 847 CDS 100% 13.200 6.600 Y Sp110 n/a
2 TRCN0000178800 CAGAATGAAGAGGAGTCAGAT pLKO.1 287 CDS 100% 4.950 2.475 Y A530032D15Rik n/a
3 TRCN0000193214 CTTTGTGGAAAGATGACTCAT pLKO.1 975 CDS 100% 4.950 2.475 Y Sp110 n/a
4 TRCN0000184720 CCACAATGCAATGGAGGAGTT pLKO.1 734 CDS 100% 4.050 2.025 Y A530032D15Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.