Transcript: Mouse XM_017321887.1

PREDICTED: Mus musculus predicted gene 15854 (Gm15854), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm15854 (667764)
Length:
804
CDS:
1..804

Additional Resources:

NCBI RefSeq record:
XM_017321887.1
NBCI Gene record:
Gm15854 (667764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256456 GGTTCTGTTATGGTATGAAAT pLKO_005 443 CDS 100% 13.200 6.600 Y Klra4 n/a
2 TRCN0000265819 TGCTGGATTGGATTGTCATAT pLKO_005 598 CDS 100% 13.200 6.600 Y Klra4 n/a
3 TRCN0000256457 TTTCCCTTCGACTGGTAATTG pLKO_005 161 CDS 100% 13.200 6.600 Y Klra4 n/a
4 TRCN0000065753 CTTGCCTTGAACACAATGAAA pLKO.1 667 CDS 100% 5.625 2.813 Y Klra12 n/a
5 TRCN0000067919 GCAGTGCTTGTGACAAACATT pLKO.1 184 CDS 100% 5.625 2.813 Y Klra16 n/a
6 TRCN0000067965 TGGTTCTGTTATGGTATGAAA pLKO.1 442 CDS 100% 5.625 2.813 Y Klra18 n/a
7 TRCN0000065461 CCACAATAACTGCAGCATCAT pLKO.1 252 CDS 100% 4.950 2.475 Y Klra4 n/a
8 TRCN0000067963 CCCTGGCAGTTCATTGTGATA pLKO.1 124 CDS 100% 4.950 2.475 Y Klra18 n/a
9 TRCN0000065756 CCTTCAGACAGTTGCTGGATT pLKO.1 586 CDS 100% 4.950 2.475 Y Klra12 n/a
10 TRCN0000065647 GACTGGATAAATTCCCTCATT pLKO.1 782 CDS 100% 4.950 2.475 Y Klra7 n/a
11 TRCN0000068283 CATTGTGATAGCTCTCGGAAT pLKO.1 135 CDS 100% 4.050 2.025 Y Klra23 n/a
12 TRCN0000067967 CTGGTAATTGTTGCAGTGCTT pLKO.1 172 CDS 100% 2.640 1.320 Y Klra18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.