Transcript: Mouse XM_017321896.1

PREDICTED: Mus musculus predicted gene 4070 (Gm4070), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm4070 (100042856)
Length:
8540
CDS:
59..7342

Additional Resources:

NCBI RefSeq record:
XM_017321896.1
NBCI Gene record:
Gm4070 (100042856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246463 CAGAACATGGCACCGAAATAA pLKO_005 723 CDS 100% 15.000 7.500 Y Gvin1 n/a
2 TRCN0000246464 CATGTTTACAGAGACTATAAA pLKO_005 778 CDS 100% 15.000 7.500 Y Gvin1 n/a
3 TRCN0000215513 GAGATTGTTCCTTCGTAAATA pLKO.1 7984 3UTR 100% 15.000 7.500 Y Gvin1 n/a
4 TRCN0000246462 GAGATTGTTCCTTCGTAAATA pLKO_005 7984 3UTR 100% 15.000 7.500 Y Gvin1 n/a
5 TRCN0000216348 GATCTTACCAGGCAATATATT pLKO.1 3020 CDS 100% 15.000 7.500 Y Gvin1 n/a
6 TRCN0000246461 TGATCTTACCAGGCAATATAT pLKO_005 3019 CDS 100% 15.000 7.500 Y Gvin1 n/a
7 TRCN0000246460 AGCTAACCTGGAGATACATAT pLKO_005 6445 CDS 100% 13.200 6.600 Y Gvin1 n/a
8 TRCN0000216869 GAGGATCTGCAGTAGACATTT pLKO.1 7423 3UTR 100% 13.200 6.600 Y Gvin1 n/a
9 TRCN0000174600 GCGTGATTACAGTCAGAATTA pLKO.1 6055 CDS 100% 13.200 6.600 Y Gvin1 n/a
10 TRCN0000173437 CCTGCTATCTCTGTCAGCATA pLKO.1 6356 CDS 100% 4.950 2.475 Y Gvin1 n/a
11 TRCN0000174321 CCTAGAAGAGAATTATGGCAA pLKO.1 7240 CDS 100% 2.640 1.320 Y Gvin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.