Transcript: Mouse XM_017321920.1

PREDICTED: Mus musculus SH3-binding kinase 1 (Sbk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sbk1 (104175)
Length:
4339
CDS:
719..1972

Additional Resources:

NCBI RefSeq record:
XM_017321920.1
NBCI Gene record:
Sbk1 (104175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419127 TGCAGGAACAGACCCGATTAT pLKO_005 2425 3UTR 100% 13.200 18.480 N Sbk1 n/a
2 TRCN0000421028 GACCGAGGAGTGCTATGTCTT pLKO_005 1075 CDS 100% 4.950 6.930 N Sbk1 n/a
3 TRCN0000426081 AGTAAAGGGCAGGTGGTACTG pLKO_005 1925 CDS 100% 4.050 5.670 N Sbk1 n/a
4 TRCN0000088467 CTGCGTATGTTCCAGCGGCTT pLKO.1 1583 CDS 100% 0.720 1.008 N Sbk1 n/a
5 TRCN0000088466 CGATGTTACCAAGCACTATGA pLKO.1 859 CDS 100% 4.950 3.960 N Sbk1 n/a
6 TRCN0000037396 CAAGGTCTTTGACGTGGTCTT pLKO.1 1051 CDS 100% 4.050 3.240 N SBK1 n/a
7 TRCN0000420985 CAAGGTCTTTGACGTGGTCTT pLKO_005 1051 CDS 100% 4.050 3.240 N Sbk1 n/a
8 TRCN0000088464 CCCGAGAATGTGCTGCTGTTT pLKO.1 1247 CDS 100% 4.950 3.465 N Sbk1 n/a
9 TRCN0000088463 CCCTACAGTATTCCATCCAAA pLKO.1 2252 3UTR 100% 4.950 3.465 N Sbk1 n/a
10 TRCN0000088465 CAGCGATGTTACCAAGCACTA pLKO.1 856 CDS 100% 4.050 2.835 N Sbk1 n/a
11 TRCN0000037398 CCCTTCATCATCAAGGTCTTT pLKO.1 1040 CDS 100% 4.950 2.970 N SBK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.