Transcript: Mouse XM_017321924.1

PREDICTED: Mus musculus Fc receptor, IgA, IgM, high affinity (Fcamr), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fcamr (64435)
Length:
2033
CDS:
71..1828

Additional Resources:

NCBI RefSeq record:
XM_017321924.1
NBCI Gene record:
Fcamr (64435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440865 TGCTATTCTTCAGCGTGAATC pLKO_005 762 CDS 100% 10.800 8.640 N Fcamr n/a
2 TRCN0000450397 CCAAGTGCACAGACCTTAAAT pLKO_005 1385 CDS 100% 15.000 10.500 N Fcamr n/a
3 TRCN0000442918 AGAGGTGTCTAAGCAACAAAT pLKO_005 1333 CDS 100% 13.200 9.240 N Fcamr n/a
4 TRCN0000099886 GAACTCCCTTTCAGGTACAAA pLKO.1 445 CDS 100% 5.625 3.938 N Fcamr n/a
5 TRCN0000099885 GCTGCTCTGATCCTATTGAAA pLKO.1 1628 CDS 100% 5.625 3.938 N Fcamr n/a
6 TRCN0000099887 CTCTAATTCAGATGACACATT pLKO.1 1704 CDS 100% 4.950 3.465 N Fcamr n/a
7 TRCN0000099888 GCTTCTAATTGCTGCTCTGAT pLKO.1 1618 CDS 100% 4.950 3.465 N Fcamr n/a
8 TRCN0000099889 TCCTCAGTCAACAGGCATCAA pLKO.1 539 CDS 100% 4.950 3.465 N Fcamr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.