Transcript: Mouse XM_017322025.1

PREDICTED: Mus musculus otogelin (Otog), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Otog (18419)
Length:
10019
CDS:
1..8754

Additional Resources:

NCBI RefSeq record:
XM_017322025.1
NBCI Gene record:
Otog (18419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097728 CGTTGCCAGTTGGTGTATAAT pLKO.1 388 CDS 100% 15.000 21.000 N Otog n/a
2 TRCN0000097726 GCAGTAACTAAGGTGGCAAAT pLKO.1 5017 CDS 100% 10.800 15.120 N Otog n/a
3 TRCN0000447970 TTCATCTATAACGAGTGTATT pLKO_005 1252 CDS 100% 13.200 10.560 N Otog n/a
4 TRCN0000097729 CCTGGGCCTTACAACATCTAA pLKO.1 4611 CDS 100% 5.625 4.500 N Otog n/a
5 TRCN0000097727 GCAGGAGATGTCCTTCTATTT pLKO.1 1738 CDS 100% 13.200 9.240 N Otog n/a
6 TRCN0000444129 CCAAGTACGAGTGCGTGAAAG pLKO_005 8009 CDS 100% 10.800 7.560 N Otog n/a
7 TRCN0000444888 CCAATGCTGGCTTAGGGTTAA pLKO_005 9157 3UTR 100% 10.800 7.560 N Otog n/a
8 TRCN0000097725 GCCAGGTTTGAGATACATGAA pLKO.1 9463 3UTR 100% 4.950 3.465 N Otog n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.