Transcript: Mouse XM_017322031.1

PREDICTED: Mus musculus paternally expressed 3 (Peg3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Peg3 (18616)
Length:
8710
CDS:
381..5096

Additional Resources:

NCBI RefSeq record:
XM_017322031.1
NBCI Gene record:
Peg3 (18616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075396 GCCGAGTCATACCAGAATGTT pLKO.1 678 CDS 100% 5.625 7.875 N Peg3 n/a
2 TRCN0000318263 GCCGAGTCATACCAGAATGTT pLKO_005 678 CDS 100% 5.625 7.875 N Peg3 n/a
3 TRCN0000075395 CCCTAATGACAAGCTGAAATT pLKO.1 2303 CDS 100% 13.200 10.560 N Peg3 n/a
4 TRCN0000318325 CCCTAATGACAAGCTGAAATT pLKO_005 2303 CDS 100% 13.200 10.560 N Peg3 n/a
5 TRCN0000075397 CCACTGTACGAATGCAAAGAT pLKO.1 4323 CDS 100% 5.625 3.938 N Peg3 n/a
6 TRCN0000318264 CCACTGTACGAATGCAAAGAT pLKO_005 4323 CDS 100% 5.625 3.938 N Peg3 n/a
7 TRCN0000075394 CCTCCATTTATATCCCAGATA pLKO.1 2620 CDS 100% 4.950 3.465 N Peg3 n/a
8 TRCN0000075393 CCTCTTAGATAGTCCTGTGAA pLKO.1 5715 3UTR 100% 4.950 3.465 N Peg3 n/a
9 TRCN0000318254 CCTCTTAGATAGTCCTGTGAA pLKO_005 5715 3UTR 100% 4.950 3.465 N Peg3 n/a
10 TRCN0000178741 CACACACATACACACACACAA pLKO.1 6387 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.