Transcript: Mouse XM_017322058.1

PREDICTED: Mus musculus ryanodine receptor 1, skeletal muscle (Ryr1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ryr1 (20190)
Length:
9469
CDS:
155..9385

Additional Resources:

NCBI RefSeq record:
XM_017322058.1
NBCI Gene record:
Ryr1 (20190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103014 CGACAGGAGTTAGTCAACTTT pLKO.1 6260 CDS 100% 5.625 7.875 N Ryr1 n/a
2 TRCN0000103013 GCTGCCTAAGACGTATATGAT pLKO.1 3040 CDS 100% 5.625 7.875 N Ryr1 n/a
3 TRCN0000103010 GCGGAATTACAACTTGCAGAT pLKO.1 2929 CDS 100% 4.050 5.670 N Ryr1 n/a
4 TRCN0000359102 CAACACCACCACGTACTATTA pLKO_005 4462 CDS 100% 13.200 10.560 N RYR1 n/a
5 TRCN0000447817 GACATCCCTGCACGCAGAAAT pLKO_005 3212 CDS 100% 13.200 9.240 N Ryr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.