Transcript: Mouse XM_017322082.1

PREDICTED: Mus musculus Fanconi anemia, complementation group I (Fanci), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fanci (208836)
Length:
4450
CDS:
183..3896

Additional Resources:

NCBI RefSeq record:
XM_017322082.1
NBCI Gene record:
Fanci (208836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277509 ATGTAAGCTGGGAGCTAATAT pLKO_005 1157 CDS 100% 15.000 21.000 N Fanci n/a
2 TRCN0000181275 CCGTTATTCTGCACATCGTAT pLKO.1 712 CDS 100% 4.950 6.930 N Fanci n/a
3 TRCN0000277583 CCGTTATTCTGCACATCGTAT pLKO_005 712 CDS 100% 4.950 6.930 N Fanci n/a
4 TRCN0000277585 ACCTGTAAGACGGTGGAAATT pLKO_005 4221 3UTR 100% 13.200 9.240 N Fanci n/a
5 TRCN0000198418 GCATCAGAGATCATAGGATTA pLKO.1 159 5UTR 100% 10.800 7.560 N Fanci n/a
6 TRCN0000177566 CAGAGATCATAGGATTACTAA pLKO.1 163 5UTR 100% 5.625 3.938 N Fanci n/a
7 TRCN0000277582 CAGAGATCATAGGATTACTAA pLKO_005 163 5UTR 100% 5.625 3.938 N Fanci n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.