Transcript: Mouse XM_017322091.1

PREDICTED: Mus musculus SH3/ankyrin domain gene 2 (Shank2), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shank2 (210274)
Length:
9813
CDS:
770..6454

Additional Resources:

NCBI RefSeq record:
XM_017322091.1
NBCI Gene record:
Shank2 (210274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253292 GCGCCAAGGGATTGCTGTAAT pLKO_005 3403 CDS 100% 13.200 18.480 N Shank2 n/a
2 TRCN0000265363 GTACGATGCGAAGGCAGAAAT pLKO_005 3477 CDS 100% 13.200 18.480 N Shank2 n/a
3 TRCN0000253293 GTGGTTTCACCAACGGAATTG pLKO_005 6029 CDS 100% 10.800 8.640 N Shank2 n/a
4 TRCN0000253294 CCAAGAGTCTATGGGACAATT pLKO_005 3692 CDS 100% 13.200 9.240 N Shank2 n/a
5 TRCN0000218664 CTGCAAACAGATTAGCATAAT pLKO_005 7058 3UTR 100% 13.200 9.240 N Shank2 n/a
6 TRCN0000229603 TCCGGAAGAAGAAGGATAAAC pLKO_005 3246 CDS 100% 13.200 9.240 N Shank2 n/a
7 TRCN0000218949 TTGCAACAGCCAATCTCAAAT pLKO_005 6209 CDS 100% 13.200 9.240 N Shank2 n/a
8 TRCN0000229602 GGACTTCTTGATTGAGGTTAA pLKO_005 2986 CDS 100% 10.800 7.560 N Shank2 n/a
9 TRCN0000253295 GTCACACGGAGTTAGTCAAAG pLKO_005 7099 3UTR 100% 10.800 7.560 N Shank2 n/a
10 TRCN0000040278 GCCAATCTCAAATAAGCCTTT pLKO.1 6217 CDS 100% 4.050 2.835 N SHANK2 n/a
11 TRCN0000040280 GCAGAATCTTTCTATCAGGAA pLKO.1 3507 CDS 100% 2.640 2.112 N SHANK2 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8340 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.