Transcript: Mouse XM_017322128.2

PREDICTED: Mus musculus vomeronasal 2, receptor 30 (Vmn2r30), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r30 (22306)
Length:
2472
CDS:
1..2409

Additional Resources:

NCBI RefSeq record:
XM_017322128.2
NBCI Gene record:
Vmn2r30 (22306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027930 CGGATGAATATTTGGGATTAT pLKO.1 104 CDS 100% 13.200 6.600 Y Vmn2r42 n/a
2 TRCN0000104993 CTGTAACACCTACACCATATT pLKO.1 329 CDS 100% 13.200 6.600 Y Vmn2r30 n/a
3 TRCN0000226089 CTCTGTGTGCAGTGCAGATTG pLKO_005 1539 CDS 100% 10.800 5.400 Y Gm3670 n/a
4 TRCN0000104992 TGGATGAAATAACGGATGAAT pLKO.1 92 CDS 100% 5.625 2.813 Y Vmn2r30 n/a
5 TRCN0000104991 CAATGGATGAAATCAACAGAA pLKO.1 242 CDS 100% 4.950 2.475 Y Vmn2r30 n/a
6 TRCN0000104990 CCCAGGGAGAAGATTGAGAAA pLKO.1 1902 CDS 100% 4.950 2.475 Y Vmn2r30 n/a
7 TRCN0000027869 GCACATTCTATGGATCACTTA pLKO.1 944 CDS 100% 4.950 2.475 Y LOC381842 n/a
8 TRCN0000104914 CCACAAATATGCTTTGGCATT pLKO.1 213 CDS 100% 4.050 2.025 Y Vmn2r43 n/a
9 TRCN0000027909 CCCAACTACATTATTCCCATA pLKO.1 1942 CDS 100% 4.050 2.025 Y Vmn2r37 n/a
10 TRCN0000104874 GTTAGGAAAGTTCAGCCCATA pLKO.1 1443 CDS 100% 4.050 2.025 Y Vmn2r29 n/a
11 TRCN0000104994 CAGTTCAGACACCCACTGAAA pLKO.1 146 CDS 100% 0.495 0.248 Y Vmn2r30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.