Transcript: Mouse XM_017322200.1

PREDICTED: Mus musculus DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (Dcun1d3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dcun1d3 (233805)
Length:
5555
CDS:
231..1145

Additional Resources:

NCBI RefSeq record:
XM_017322200.1
NBCI Gene record:
Dcun1d3 (233805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179063 CCGTCCCTTTAAGCTAATTTA pLKO.1 1775 3UTR 100% 15.000 21.000 N Dcun1d3 n/a
2 TRCN0000243523 GCGGTCACTGCATCGTGAAAT pLKO_005 821 CDS 100% 13.200 18.480 N Dcun1d3 n/a
3 TRCN0000243524 ATGAGCGGGAGGATGCAATTT pLKO_005 529 CDS 100% 13.200 10.560 N Dcun1d3 n/a
4 TRCN0000196100 GCCGAGTCTCTTTGATACCTT pLKO.1 1028 CDS 100% 3.000 2.400 N Dcun1d3 n/a
5 TRCN0000243522 ATTGGACCAGTGGCTAAATTT pLKO_005 890 CDS 100% 15.000 10.500 N Dcun1d3 n/a
6 TRCN0000243521 TTACTGAAGATCCGGATATTT pLKO_005 1223 3UTR 100% 15.000 10.500 N Dcun1d3 n/a
7 TRCN0000183610 GCTGTTTACATGGTTGAATTT pLKO.1 1603 3UTR 100% 13.200 9.240 N Dcun1d3 n/a
8 TRCN0000243525 TCAAGGATCTCTACCGGTTTA pLKO_005 766 CDS 100% 10.800 7.560 N Dcun1d3 n/a
9 TRCN0000151793 CTCTTAACAGAAGCCAAACAA pLKO.1 735 CDS 100% 5.625 3.938 N DCUN1D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.