Transcript: Mouse XM_017322249.1

PREDICTED: Mus musculus zinc finger protein 536 (Zfp536), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp536 (243937)
Length:
8057
CDS:
1082..5224

Additional Resources:

NCBI RefSeq record:
XM_017322249.1
NBCI Gene record:
Zfp536 (243937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322249.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242043 GAACACGGCTTCTTATCTAAA pLKO_005 2681 CDS 100% 13.200 18.480 N Zfp536 n/a
2 TRCN0000242044 TGGATCGCCACATCCGCATTT pLKO_005 1947 CDS 100% 10.800 15.120 N Zfp536 n/a
3 TRCN0000242042 CCCGAAAGAACCGGAAGTATC pLKO_005 1452 CDS 100% 10.800 8.640 N Zfp536 n/a
4 TRCN0000194323 CGGCTTCTTATCTAAAGAGCA pLKO.1 2686 CDS 100% 2.640 2.112 N Zfp536 n/a
5 TRCN0000242041 CTAGAAGGCAGTCGGGAATTT pLKO_005 2882 CDS 100% 13.200 9.240 N Zfp536 n/a
6 TRCN0000151027 GATTTGGTTCACAGCACTAAA pLKO.1 2822 CDS 100% 13.200 9.240 N ZNF536 n/a
7 TRCN0000312433 GATTTGGTTCACAGCACTAAA pLKO_005 2822 CDS 100% 13.200 9.240 N ZNF536 n/a
8 TRCN0000173329 GAGATCGGAAGAGCTTATCAA pLKO.1 3782 CDS 100% 5.625 3.938 N Zfp536 n/a
9 TRCN0000156512 GCTGATTTGGTTCACAGCACT pLKO.1 2819 CDS 100% 2.640 1.848 N ZNF536 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322249.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.