Transcript: Mouse XM_017322266.1

PREDICTED: Mus musculus ankyrin repeat domain 27 (VPS9 domain) (Ankrd27), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ankrd27 (245886)
Length:
3838
CDS:
322..2856

Additional Resources:

NCBI RefSeq record:
XM_017322266.1
NBCI Gene record:
Ankrd27 (245886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248745 GTATGTCCATCACGATATTTA pLKO_005 351 CDS 100% 15.000 21.000 N Ankrd27 n/a
2 TRCN0000248744 ACCACATAGACTCCGTAAATG pLKO_005 227 5UTR 100% 13.200 18.480 N Ankrd27 n/a
3 TRCN0000248746 CAGGCCTGCAGATTGGATATT pLKO_005 1369 CDS 100% 13.200 10.560 N Ankrd27 n/a
4 TRCN0000248743 GATTTGGCGACAGACTATTTC pLKO_005 836 CDS 100% 13.200 10.560 N Ankrd27 n/a
5 TRCN0000248742 CTTAAGTCTTTCGATTCAAAT pLKO_005 3513 3UTR 100% 13.200 7.920 N Ankrd27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.