Transcript: Mouse XM_017322267.1

PREDICTED: Mus musculus otoancorin (Otoa), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Otoa (246190)
Length:
4894
CDS:
1319..4732

Additional Resources:

NCBI RefSeq record:
XM_017322267.1
NBCI Gene record:
Otoa (246190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125527 CGGAAGAAATAATAGAGGGAA pLKO.1 1437 CDS 100% 2.640 3.696 N Otoa n/a
2 TRCN0000125526 CCCACTGAAATACAACTTATA pLKO.1 4199 CDS 100% 13.200 10.560 N Otoa n/a
3 TRCN0000118992 GCGTGGAAATACTGGGAAGTT pLKO.1 3137 CDS 100% 4.950 3.960 N OTOA n/a
4 TRCN0000125525 GCAGTGTTCAAAGACCTCTAT pLKO.1 1958 CDS 100% 4.950 3.465 N Otoa n/a
5 TRCN0000125524 GCCTGTTGAGTGTTGCAAGAA pLKO.1 4742 3UTR 100% 4.950 3.465 N Otoa n/a
6 TRCN0000125528 GTCATCAACTTGGGAGACATT pLKO.1 1733 CDS 100% 4.950 3.465 N Otoa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.