Transcript: Mouse XM_017322270.1

PREDICTED: Mus musculus olfactory receptor 671 (Olfr671), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfr671 (257910)
Length:
966
CDS:
1..966

Additional Resources:

NCBI RefSeq record:
XM_017322270.1
NBCI Gene record:
Olfr671 (257910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187577 GTGTTTCTCCTACTGAGGCTA pLKO.1 496 CDS 100% 2.640 1.848 N Olfr671 n/a
2 TRCN0000203427 CCGCTACATTGCCATTTGTAA pLKO.1 381 CDS 100% 5.625 3.375 N Olfr671 n/a
3 TRCN0000202775 CCTGGATGTAGTTCTTATTAT pLKO.1 639 CDS 100% 15.000 7.500 Y Olfr675 n/a
4 TRCN0000186107 CTCCTTCTTGACACATCGTTT pLKO.1 786 CDS 100% 4.950 2.475 Y Olfr675 n/a
5 TRCN0000185596 GTCAACATCATGTTTGGTCTT pLKO.1 598 CDS 100% 4.050 2.025 Y Olfr671 n/a
6 TRCN0000060815 GCCAGCATCAAAGTCAACATT pLKO.1 586 CDS 100% 5.625 2.813 Y OR52E8 n/a
7 TRCN0000204164 GCCAGCATCAAAGTCAACATT pLKO.1 586 CDS 100% 5.625 2.813 Y OR52E6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.