Transcript: Mouse XM_017322271.1

PREDICTED: Mus musculus olfactory receptor 1532, pseudogene 1 (Olfr1532-ps1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfr1532-ps1 (258173)
Length:
1147
CDS:
68..1147

Additional Resources:

NCBI RefSeq record:
XM_017322271.1
NBCI Gene record:
Olfr1532-ps1 (258173)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185797 GAACATTGTCTCTACTGTAAT pLKO.1 880 CDS 100% 13.200 6.600 Y Olfr1532-ps1 n/a
2 TRCN0000187278 CTTTGCAATGGGTGTGGTAAT pLKO.1 820 CDS 100% 10.800 5.400 Y Olfr1532-ps1 n/a
3 TRCN0000188344 CCATCATGACACACTGGGTAT pLKO.1 624 CDS 100% 4.050 2.025 Y Olfr707 n/a
4 TRCN0000204758 GTGATGTCCTATGACCGCTAT pLKO.1 572 CDS 100% 4.050 2.025 Y Olfr1532-ps1 n/a
5 TRCN0000202520 CATTCACATTACGTCTTCCTT pLKO.1 705 CDS 100% 3.000 1.500 Y Olfr707 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.