Transcript: Mouse XM_017322287.1

PREDICTED: Mus musculus mitogen-activated protein kinase kinase kinase 10 (Map3k10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map3k10 (269881)
Length:
3846
CDS:
586..3561

Additional Resources:

NCBI RefSeq record:
XM_017322287.1
NBCI Gene record:
Map3k10 (269881)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321744 GCATGAACTATCTACACAATG pLKO_005 1202 CDS 100% 10.800 15.120 N Map3k10 n/a
2 TRCN0000321742 TGTAACTCTACGCGCTCATTG pLKO_005 2977 CDS 100% 10.800 15.120 N Map3k10 n/a
3 TRCN0000022513 TGGTGTCATTATCCTCTGTAT pLKO.1 2951 CDS 100% 4.950 6.930 N Map3k10 n/a
4 TRCN0000321680 TGGTGTCATTATCCTCTGTAT pLKO_005 2951 CDS 100% 4.950 6.930 N Map3k10 n/a
5 TRCN0000022509 GCTATGAACAAGCTGACGCTA pLKO.1 1531 CDS 100% 2.640 3.696 N Map3k10 n/a
6 TRCN0000321743 GCAGGATACTCACTCTATTTA pLKO_005 3654 3UTR 100% 15.000 12.000 N Map3k10 n/a
7 TRCN0000022511 GCCCTCTGGATTTGAACATAA pLKO.1 2166 CDS 100% 13.200 9.240 N Map3k10 n/a
8 TRCN0000022512 CAAGTCCATCAACATCCTAAT pLKO.1 1254 CDS 100% 10.800 7.560 N Map3k10 n/a
9 TRCN0000001990 CCTCAAGTCCATCAACATCCT pLKO.1 1251 CDS 100% 2.640 1.848 N MAP3K10 n/a
10 TRCN0000022510 CCTCAACGAGATGGAAGAATT pLKO.1 2544 CDS 100% 0.000 0.000 N Map3k10 n/a
11 TRCN0000321740 CCTCAACGAGATGGAAGAATT pLKO_005 2544 CDS 100% 0.000 0.000 N Map3k10 n/a
12 TRCN0000001991 GAAGACTGGAAGCTGGAGATT pLKO.1 1741 CDS 100% 4.950 2.970 N MAP3K10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.