Transcript: Mouse XM_017322299.1

PREDICTED: Mus musculus zinc finger protein 865 (Zfp865), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp865 (319748)
Length:
4430
CDS:
214..3576

Additional Resources:

NCBI RefSeq record:
XM_017322299.1
NBCI Gene record:
Zfp865 (319748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242143 CATCCACTACCGACGAGAAAG pLKO_005 1883 CDS 100% 10.800 15.120 N Zfp865 n/a
2 TRCN0000242144 CGCCCTCTCAGGAACTGATTT pLKO_005 4021 3UTR 100% 13.200 9.240 N Zfp865 n/a
3 TRCN0000242142 CACTTCCAGAGTTACCCATTT pLKO_005 472 CDS 100% 10.800 7.560 N Zfp865 n/a
4 TRCN0000242141 CGGCCAAAGCTTCAAGCATTT pLKO_005 2787 CDS 100% 10.800 7.560 N Zfp865 n/a
5 TRCN0000242145 TCTACCTGAGCTCCGTGTTAC pLKO_005 3305 CDS 100% 10.800 7.560 N Zfp865 n/a
6 TRCN0000193750 CCTCATCTTCATCATCATCTT pLKO.1 677 CDS 100% 4.950 2.970 N Zfp865 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.