Transcript: Mouse XM_017322368.1

PREDICTED: Mus musculus deformed epidermal autoregulatory factor 1 (Drosophila) (Deaf1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Deaf1 (54006)
Length:
2185
CDS:
158..1855

Additional Resources:

NCBI RefSeq record:
XM_017322368.1
NBCI Gene record:
Deaf1 (54006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311025 AGGCTCTTCGTCCCTTATAAA pLKO_005 1043 CDS 100% 15.000 21.000 N Deaf1 n/a
2 TRCN0000304549 CGAATCTGGGCACATGGATAT pLKO_005 370 CDS 100% 10.800 15.120 N Deaf1 n/a
3 TRCN0000348099 GGCGAGAATGCAGGTTGATAC pLKO_005 1630 CDS 100% 10.800 15.120 N Deaf1 n/a
4 TRCN0000085143 CGGACAAGTTATTAACAGATT pLKO.1 1954 3UTR 100% 4.950 6.930 N Deaf1 n/a
5 TRCN0000085144 CGGTGTATCAAGCAGGGAGAA pLKO.1 836 CDS 100% 4.050 5.670 N Deaf1 n/a
6 TRCN0000301924 CGGTGTATCAAGCAGGGAGAA pLKO_005 836 CDS 100% 4.050 5.670 N Deaf1 n/a
7 TRCN0000348098 CTTGCCGGACAAGTTATTAAC pLKO_005 1949 3UTR 100% 13.200 10.560 N Deaf1 n/a
8 TRCN0000085147 CAGGCGAGAATGCAGGTTGAT pLKO.1 1628 CDS 100% 4.950 3.960 N Deaf1 n/a
9 TRCN0000085146 CCCAAGAACATCACCCTGCTT pLKO.1 1115 CDS 100% 2.640 2.112 N Deaf1 n/a
10 TRCN0000348162 GGCAAACGCAGCATCGATATC pLKO_005 514 CDS 100% 10.800 7.560 N Deaf1 n/a
11 TRCN0000311024 GAACGCTGGCAGCTTTCAGAA pLKO_005 2010 3UTR 100% 4.950 3.465 N Deaf1 n/a
12 TRCN0000085145 GCAGCATCGATATCAGGACAT pLKO.1 521 CDS 100% 4.050 2.835 N Deaf1 n/a
13 TRCN0000232488 TAGAGGCCACTGCTGTCATAT pLKO_005 1224 CDS 100% 13.200 9.240 N DEAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.