Transcript: Human XM_024446052.1

PREDICTED: Homo sapiens MCC regulator of WNT signaling pathway (MCC), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCC (4163)
Length:
8187
CDS:
620..2986

Additional Resources:

NCBI RefSeq record:
XM_024446052.1
NBCI Gene record:
MCC (4163)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422216 AGAGTTCGTGAATGATCTAAA pLKO_005 2773 CDS 100% 13.200 10.560 N MCC n/a
2 TRCN0000431593 TGCGACACCGAGTTCACTAAA pLKO_005 2099 CDS 100% 13.200 10.560 N MCC n/a
3 TRCN0000038165 GCTCCAATATCCAAGAGATTT pLKO.1 1542 CDS 100% 13.200 9.240 N MCC n/a
4 TRCN0000038166 CACCAATGAAACTTCGCTTTA pLKO.1 2965 CDS 100% 10.800 7.560 N MCC n/a
5 TRCN0000429890 GAAGAACTGAACCGGACTAAG pLKO_005 1190 CDS 100% 10.800 7.560 N MCC n/a
6 TRCN0000422783 GAGAGGGTGAAGCTATCAAAG pLKO_005 1412 CDS 100% 10.800 7.560 N MCC n/a
7 TRCN0000038167 GAAAGCAAGATTAGAGAGTTT pLKO.1 1598 CDS 100% 4.950 3.465 N MCC n/a
8 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4830 3UTR 100% 4.950 2.475 Y n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4900 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4900 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.