Transcript: Human XM_024446056.1

PREDICTED: Homo sapiens myocyte enhancer factor 2C (MEF2C), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEF2C (4208)
Length:
3856
CDS:
168..1589

Additional Resources:

NCBI RefSeq record:
XM_024446056.1
NBCI Gene record:
MEF2C (4208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015813 GCCTAGAATTTGATACGCTTT pLKO.1 2998 3UTR 100% 4.050 5.670 N MEF2C n/a
2 TRCN0000280285 GCCTAGAATTTGATACGCTTT pLKO_005 2998 3UTR 100% 4.050 5.670 N MEF2C n/a
3 TRCN0000015814 GCAGCAAGAATACGATGCCAT pLKO.1 952 CDS 100% 2.640 3.696 N MEF2C n/a
4 TRCN0000280636 GCAGCAAGAATACGATGCCAT pLKO_005 952 CDS 100% 2.640 3.696 N MEF2C n/a
5 TRCN0000015815 GCACTCATTTATCTCAGAGTT pLKO.1 1279 CDS 100% 4.950 3.960 N MEF2C n/a
6 TRCN0000012068 GCCTCAGTGATACAGTATAAA pLKO.1 1741 3UTR 100% 15.000 10.500 N Mef2c n/a
7 TRCN0000015817 CCCAATGAATTTAGGAATGAA pLKO.1 893 CDS 100% 5.625 3.938 N MEF2C n/a
8 TRCN0000280349 CCCAATGAATTTAGGAATGAA pLKO_005 893 CDS 100% 5.625 3.938 N MEF2C n/a
9 TRCN0000015816 CGTGGAGACGTTGAGAAAGAA pLKO.1 419 CDS 100% 5.625 3.938 N MEF2C n/a
10 TRCN0000280635 CGTGGAGACGTTGAGAAAGAA pLKO_005 419 CDS 100% 5.625 3.938 N MEF2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.