Transcript: Human XM_024446170.1

PREDICTED: Homo sapiens required for meiotic nuclear division 5 homolog B (RMND5B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RMND5B (64777)
Length:
1908
CDS:
67..1371

Additional Resources:

NCBI RefSeq record:
XM_024446170.1
NBCI Gene record:
RMND5B (64777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033906 GCTTCGGACCATAAGGACATT pLKO.1 292 CDS 100% 4.950 6.930 N RMND5B n/a
2 TRCN0000308008 TCGGTAGGGTGGTCAACTTCA pLKO_005 1430 3UTR 100% 4.950 6.930 N RMND5B n/a
3 TRCN0000295080 CAGATGGGAAACGCATCATAT pLKO_005 1346 CDS 100% 13.200 10.560 N Rmnd5b n/a
4 TRCN0000033908 GCAGATGGGAAACGCATCATA pLKO.1 1345 CDS 100% 5.625 4.500 N RMND5B n/a
5 TRCN0000331114 GCAGATGGGAAACGCATCATA pLKO_005 1345 CDS 100% 5.625 4.500 N RMND5B n/a
6 TRCN0000033904 GCACTCAATAAGCTCATTAAT pLKO.1 1279 CDS 100% 15.000 10.500 N RMND5B n/a
7 TRCN0000298726 GCACTCAATAAGCTCATTAAT pLKO_005 1279 CDS 100% 15.000 10.500 N RMND5B n/a
8 TRCN0000369965 TTCTGTTTGCGTTTGACTTAG pLKO_005 1626 3UTR 100% 10.800 7.560 N RMND5B n/a
9 TRCN0000033905 GCTGCCTGTGTTGATGAACAT pLKO.1 1071 CDS 100% 4.950 3.465 N RMND5B n/a
10 TRCN0000298795 GCTGCCTGTGTTGATGAACAT pLKO_005 1071 CDS 100% 4.950 3.465 N RMND5B n/a
11 TRCN0000033907 CTTGGATTTCAAGCAGCCTTT pLKO.1 636 CDS 100% 4.050 2.835 N RMND5B n/a
12 TRCN0000298796 CTTGGATTTCAAGCAGCCTTT pLKO_005 636 CDS 100% 4.050 2.835 N RMND5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.