Transcript: Human XM_024446200.1

PREDICTED: Homo sapiens bromodomain containing 9 (BRD9), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRD9 (65980)
Length:
2562
CDS:
504..1835

Additional Resources:

NCBI RefSeq record:
XM_024446200.1
NBCI Gene record:
BRD9 (65980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236474 ACAAGTCAGTTACGGAATTTA pLKO_005 565 CDS 100% 15.000 21.000 N BRD9 n/a
2 TRCN0000236476 GAAGCGCAGCATGTCGTTTAT pLKO_005 716 CDS 100% 13.200 18.480 N BRD9 n/a
3 TRCN0000236472 AGTCATACGCGAAGGCCATAT pLKO_005 2025 3UTR 100% 10.800 15.120 N BRD9 n/a
4 TRCN0000127634 CGAGTAGAGAAGTTATCAGCT pLKO.1 856 CDS 100% 2.640 3.696 N BRD9 n/a
5 TRCN0000127780 GCAATGACATACAATAGGCCA pLKO.1 615 CDS 100% 0.660 0.924 N BRD9 n/a
6 TRCN0000236473 CTCCTGGATATTCAATGATAA pLKO_005 490 5UTR 100% 13.200 9.240 N BRD9 n/a
7 TRCN0000236475 GATCCTTCACGCAGGCTTTAA pLKO_005 665 CDS 100% 13.200 9.240 N BRD9 n/a
8 TRCN0000128333 GCTCCTGGATATTCAATGATA pLKO.1 489 5UTR 100% 5.625 3.938 N BRD9 n/a
9 TRCN0000128610 CAATGAAGATACAGCTGTTGA pLKO.1 776 CDS 100% 4.950 3.465 N BRD9 n/a
10 TRCN0000131081 GAGAGCACACCTATTCAGCAA pLKO.1 390 5UTR 100% 2.640 1.848 N BRD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.