Transcript: Human XM_024446233.1

PREDICTED: Homo sapiens SMC5-SMC6 complex localization factor 1 (SLF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLF1 (84250)
Length:
10171
CDS:
86..3262

Additional Resources:

NCBI RefSeq record:
XM_024446233.1
NBCI Gene record:
SLF1 (84250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246124 TCCAGCCATGTCGAGATATTA pLKO_005 1531 CDS 100% 15.000 21.000 N SLF1 n/a
2 TRCN0000246125 GAATTTCCCAGAGGTGTATTA pLKO_005 1307 CDS 100% 13.200 18.480 N SLF1 n/a
3 TRCN0000246122 ATACTAACCAAGGACTATATA pLKO_005 284 CDS 100% 15.000 12.000 N SLF1 n/a
4 TRCN0000246123 TTGGAGCAGCAATAGATTATT pLKO_005 1953 CDS 100% 15.000 10.500 N SLF1 n/a
5 TRCN0000246126 TCAGTTTGCATTGGTACTTAC pLKO_005 3300 3UTR 100% 10.800 7.560 N SLF1 n/a
6 TRCN0000134750 GTCTGATGACTTAGGAAGTTA pLKO.1 2020 CDS 100% 5.625 3.938 N SLF1 n/a
7 TRCN0000137710 GCCTTTGCATGAAGCCTGTAA pLKO.1 2614 CDS 100% 4.950 3.465 N SLF1 n/a
8 TRCN0000136120 GAGTTACTAGACCTGAACCTT pLKO.1 2363 CDS 100% 3.000 2.100 N SLF1 n/a
9 TRCN0000136178 GCAACTTGAATTTGGCTCCTT pLKO.1 2935 CDS 100% 2.640 1.848 N SLF1 n/a
10 TRCN0000134354 GCTTCAAATGTTTGTTGCAGA pLKO.1 2113 CDS 100% 2.640 1.848 N SLF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.