Transcript: Human XM_024446368.1

PREDICTED: Homo sapiens ankyrin repeat domain 6 (ANKRD6), transcript variant X37, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD6 (22881)
Length:
6371
CDS:
1988..3691

Additional Resources:

NCBI RefSeq record:
XM_024446368.1
NBCI Gene record:
ANKRD6 (22881)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158616 CCAAGGAGTCAACTATTGTAT pLKO.1 3761 3UTR 100% 5.625 7.875 N ANKRD6 n/a
2 TRCN0000162328 CCCAAGGAGTCAACTATTGTA pLKO.1 3760 3UTR 100% 5.625 7.875 N ANKRD6 n/a
3 TRCN0000161870 GCATGCTCATAATCACCCTAA pLKO.1 2602 CDS 100% 4.050 5.670 N ANKRD6 n/a
4 TRCN0000163262 GCAGAGCTAAATCCACACCAT pLKO.1 3078 CDS 100% 2.640 3.696 N ANKRD6 n/a
5 TRCN0000160562 CTAATCAACAAGCTGGAGAAT pLKO.1 2756 CDS 100% 4.950 3.465 N ANKRD6 n/a
6 TRCN0000163365 GCTGTTTCTACCCAGATGGAA pLKO.1 3527 CDS 100% 3.000 2.100 N ANKRD6 n/a
7 TRCN0000159706 GAAGTTTGAAAGCTCAGATTA pLKO.1 3951 3UTR 100% 13.200 7.920 N ANKRD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.