Transcript: Human XM_024446375.1

PREDICTED: Homo sapiens DOP1 leucine zipper like protein A (DOP1A), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOP1A (23033)
Length:
7834
CDS:
163..7530

Additional Resources:

NCBI RefSeq record:
XM_024446375.1
NBCI Gene record:
DOP1A (23033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421729 CACACTGCTCTGCGTTGTATA pLKO_005 7585 3UTR 100% 13.200 18.480 N DOP1A n/a
2 TRCN0000432480 CAACGTACACAGGAGGTAATG pLKO_005 6962 CDS 100% 10.800 15.120 N DOP1A n/a
3 TRCN0000018070 GCACCCACAATGGATTGGTTT pLKO.1 5100 CDS 100% 4.950 6.930 N DOP1A n/a
4 TRCN0000018072 GCCCATTTAAACAGGAAGCTT pLKO.1 775 CDS 100% 3.000 4.200 N DOP1A n/a
5 TRCN0000018068 CGCATCTCTTACCACTATTAA pLKO.1 5511 CDS 100% 15.000 12.000 N DOP1A n/a
6 TRCN0000423150 TAATTCCTTCGAACCTTATTA pLKO_005 1440 CDS 100% 15.000 12.000 N DOP1A n/a
7 TRCN0000415049 CACCATTGCTGGTTCCATTTA pLKO_005 7532 3UTR 100% 13.200 9.240 N DOP1A n/a
8 TRCN0000435449 GATGTTCAACAGGTAGTATTT pLKO_005 3574 CDS 100% 13.200 9.240 N DOP1A n/a
9 TRCN0000018071 GCGACGAAATCTTGAAGTTAA pLKO.1 6108 CDS 100% 13.200 9.240 N DOP1A n/a
10 TRCN0000425753 GTCTCACTGTGAATCCATTAA pLKO_005 3338 CDS 100% 13.200 9.240 N DOP1A n/a
11 TRCN0000018069 GCCAAGTACAACTCATCACAT pLKO.1 3266 CDS 100% 4.950 3.465 N DOP1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.