Transcript: Human XM_024446419.1

PREDICTED: Homo sapiens HIVEP zinc finger 2 (HIVEP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIVEP2 (3097)
Length:
9887
CDS:
909..8249

Additional Resources:

NCBI RefSeq record:
XM_024446419.1
NBCI Gene record:
HIVEP2 (3097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236548 TGTCGGCTTAGTCCGAGAAAT pLKO_005 2196 CDS 100% 13.200 18.480 N HIVEP2 n/a
2 TRCN0000022094 CGGCCTTATGTATGCAAGTTA pLKO.1 6381 CDS 100% 5.625 7.875 N HIVEP2 n/a
3 TRCN0000022097 GCCGACCCAATTCATTTGAAA pLKO.1 3334 CDS 100% 5.625 7.875 N HIVEP2 n/a
4 TRCN0000022096 CCATGCAATTAAGGCAGGATT pLKO.1 1628 CDS 100% 4.950 6.930 N HIVEP2 n/a
5 TRCN0000236545 TTTGGACACTTGGATCTAAAT pLKO_005 8599 3UTR 100% 13.200 10.560 N HIVEP2 n/a
6 TRCN0000236547 ATGGGTAGGAAGGGCATAATG pLKO_005 2256 CDS 100% 13.200 9.240 N HIVEP2 n/a
7 TRCN0000236546 GATCCAACCAACATCCTATAT pLKO_005 4421 CDS 100% 13.200 9.240 N HIVEP2 n/a
8 TRCN0000236549 TCTTCGTTGATCAGCTATTTG pLKO_005 6804 CDS 100% 13.200 9.240 N HIVEP2 n/a
9 TRCN0000022098 GCAAAGAATCTTCAGATGAAT pLKO.1 5593 CDS 100% 5.625 3.938 N HIVEP2 n/a
10 TRCN0000095774 GCTCTGATTCTGTAATACTAA pLKO.1 8708 3UTR 100% 5.625 3.938 N Hivep2 n/a
11 TRCN0000022095 GCCTTGTTTCAGTTTCAGTAT pLKO.1 4518 CDS 100% 4.950 3.465 N HIVEP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.