Transcript: Human XM_024446468.1

PREDICTED: Homo sapiens kelch like family member 20 (KLHL20), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL20 (27252)
Length:
3121
CDS:
280..1542

Additional Resources:

NCBI RefSeq record:
XM_024446468.1
NBCI Gene record:
KLHL20 (27252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116683 GCCAATCAACTCATTGATATA pLKO.1 343 CDS 100% 1.320 1.848 N KLHL20 n/a
2 TRCN0000116686 CCTCAACATTGTTGAGAGGTA pLKO.1 990 CDS 100% 0.264 0.370 N KLHL20 n/a
3 TRCN0000256251 GCCAATACATGGAGGTTATAT pLKO_005 1444 CDS 100% 15.000 12.000 N KLHL20 n/a
4 TRCN0000256249 GCCGCAAGAACGACCACTAAT pLKO_005 600 CDS 100% 13.200 10.560 N KLHL20 n/a
5 TRCN0000256250 ATGTATTAGCTACCCATTATT pLKO_005 1989 3UTR 100% 15.000 10.500 N KLHL20 n/a
6 TRCN0000256253 CACATTGTGAATCCCATATTT pLKO_005 1517 CDS 100% 15.000 10.500 N KLHL20 n/a
7 TRCN0000116682 GCACACATTAAAGAGTGTAAA pLKO.1 2534 3UTR 100% 13.200 9.240 N KLHL20 n/a
8 TRCN0000090229 GCCTGGGTCAAATACAGTATT pLKO.1 421 CDS 100% 13.200 9.240 N Klhl20 n/a
9 TRCN0000116684 GCCTTTGCTTAGTCCCAAGTT pLKO.1 489 CDS 100% 4.950 3.465 N KLHL20 n/a
10 TRCN0000116685 CCAGCCAATCAACTCATTGAT pLKO.1 340 CDS 100% 0.563 0.394 N KLHL20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.