Transcript: Human XM_024446550.1

PREDICTED: Homo sapiens EPM2A glucan phosphatase, laforin (EPM2A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPM2A (7957)
Length:
2850
CDS:
521..1366

Additional Resources:

NCBI RefSeq record:
XM_024446550.1
NBCI Gene record:
EPM2A (7957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234317 TCCAGACTGAATGGGATATTG pLKO_005 1095 CDS 100% 13.200 18.480 N EPM2A n/a
2 TRCN0000234314 ACCGTTGCTGTACTTACAATG pLKO_005 840 CDS 100% 10.800 15.120 N EPM2A n/a
3 TRCN0000234316 TCGTCAGGTGGAACATGTAAC pLKO_005 1030 CDS 100% 10.800 15.120 N EPM2A n/a
4 TRCN0000002592 CGTTCTGGTACAAGTTCCTGA pLKO.1 768 CDS 100% 2.640 3.696 N EPM2A n/a
5 TRCN0000002594 GCCACCAAGCCATGCATTATT pLKO.1 972 CDS 100% 15.000 10.500 N EPM2A n/a
6 TRCN0000234315 GCCACCAAGCCATGCATTATT pLKO_005 972 CDS 100% 15.000 10.500 N EPM2A n/a
7 TRCN0000002591 ACACCAATGAAATGAAGCACA pLKO.1 924 CDS 100% 2.640 1.848 N EPM2A n/a
8 TRCN0000002595 ACTTGGTGGATGGTGTGTATT pLKO.1 867 CDS 100% 13.200 7.920 N EPM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.