Transcript: Human XM_024446692.1

PREDICTED: Homo sapiens ITPR interacting domain containing 1 (ITPRID1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPRID1 (223075)
Length:
7513
CDS:
979..3837

Additional Resources:

NCBI RefSeq record:
XM_024446692.1
NBCI Gene record:
ITPRID1 (223075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416625 CAACAGTGACTAAATAGTATA pLKO_005 4059 3UTR 100% 13.200 18.480 N ITPRID1 n/a
2 TRCN0000429664 CAACCCATTGTCAGCTATATC pLKO_005 3932 3UTR 100% 13.200 18.480 N ITPRID1 n/a
3 TRCN0000168544 CCAAAGTTTCCGGGAGTATTT pLKO.1 3324 CDS 100% 13.200 18.480 N ITPRID1 n/a
4 TRCN0000431294 AGCGAATGCCTTGGAACAAAG pLKO_005 2169 CDS 100% 10.800 7.560 N ITPRID1 n/a
5 TRCN0000435365 GCCCAGTTCATGACGACTTTG pLKO_005 3226 CDS 100% 10.800 7.560 N ITPRID1 n/a
6 TRCN0000435781 TGTGATGATTTGCTACCTTAT pLKO_005 1663 CDS 100% 10.800 7.560 N ITPRID1 n/a
7 TRCN0000167069 CCTGGAAATGATCATACTCAA pLKO.1 2500 CDS 100% 4.950 3.465 N ITPRID1 n/a
8 TRCN0000167727 GCCTTTCTCCAAAGATGATTT pLKO.1 4217 3UTR 100% 13.200 6.600 Y ITPRID1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.