Transcript: Human XM_024446704.1

PREDICTED: Homo sapiens ubinuclein 2 (UBN2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBN2 (254048)
Length:
7914
CDS:
168..3680

Additional Resources:

NCBI RefSeq record:
XM_024446704.1
NBCI Gene record:
UBN2 (254048)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425705 ATGACAGAGTTACCGTATTAA pLKO_005 3911 3UTR 100% 15.000 21.000 N UBN2 n/a
2 TRCN0000419267 ATGTCCAGGATGATCGTTTAA pLKO_005 1225 CDS 100% 13.200 18.480 N UBN2 n/a
3 TRCN0000122877 GCCCAAGATGCTTCTTCGTTA pLKO.1 2385 CDS 100% 4.950 6.930 N UBN2 n/a
4 TRCN0000121607 CGGCTACAAGATTTAATTGAT pLKO.1 228 CDS 100% 5.625 4.500 N UBN2 n/a
5 TRCN0000085764 GCAGGGTTTCAAATCTCCCTT pLKO.1 2708 CDS 100% 2.640 2.112 N Ubn2 n/a
6 TRCN0000422835 CCACTACCTCCAGTAACTATT pLKO_005 2656 CDS 100% 13.200 9.240 N UBN2 n/a
7 TRCN0000122190 GCTATGAGTTAGAACCAAATA pLKO.1 1504 CDS 100% 13.200 9.240 N UBN2 n/a
8 TRCN0000434131 TAACCTTGTTGAGATCAAATT pLKO_005 1478 CDS 100% 13.200 9.240 N Ubn2 n/a
9 TRCN0000122270 CGTGTATTTCTGAAGAGCATT pLKO.1 6446 3UTR 100% 4.950 2.970 N UBN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.