Transcript: Human XM_024446797.1

PREDICTED: Homo sapiens negative regulator of ubiquitin like proteins 1 (NUB1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUB1 (51667)
Length:
3144
CDS:
118..1920

Additional Resources:

NCBI RefSeq record:
XM_024446797.1
NBCI Gene record:
NUB1 (51667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420939 AGCGATGGTGCTTGAACTAAA pLKO_005 573 CDS 100% 13.200 18.480 N NUB1 n/a
2 TRCN0000010852 CCTCAGATGTGGTGGTTAAAT pLKO.1 1483 CDS 100% 15.000 12.000 N NUB1 n/a
3 TRCN0000004136 GCTGGATATAGTGTGGTGTTA pLKO.1 966 CDS 100% 4.950 3.960 N NUB1 n/a
4 TRCN0000433801 ATCATGCGGCCACTCATATTA pLKO_005 1328 CDS 100% 15.000 10.500 N NUB1 n/a
5 TRCN0000431826 GAACAGAAATAGCGCTAATTT pLKO_005 1926 3UTR 100% 15.000 10.500 N NUB1 n/a
6 TRCN0000436047 ATTATAGAACAACGGGAATTG pLKO_005 344 CDS 100% 10.800 7.560 N NUB1 n/a
7 TRCN0000420654 CTGAATTACAAGTCCTCTTTG pLKO_005 2010 3UTR 100% 10.800 7.560 N NUB1 n/a
8 TRCN0000436300 TGCAGCTCTTTCTGTTCTTAC pLKO_005 1982 3UTR 100% 10.800 7.560 N NUB1 n/a
9 TRCN0000425653 TTCAAGGGATCCGAAACTATC pLKO_005 1148 CDS 100% 10.800 7.560 N NUB1 n/a
10 TRCN0000004137 CCAGAAATGACACCGTACTTA pLKO.1 733 CDS 100% 5.625 3.938 N NUB1 n/a
11 TRCN0000004135 GTGGAAATGATGTAGAGGCTT pLKO.1 1172 CDS 100% 2.640 1.848 N NUB1 n/a
12 TRCN0000004138 GCCACGCACTCCTCTGTAGAT pLKO.1 2860 3UTR 100% 1.650 0.990 N NUB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.