Transcript: Human XM_024446814.1

PREDICTED: Homo sapiens dynein axonemal assembly factor 5 (DNAAF5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAAF5 (54919)
Length:
3277
CDS:
491..2452

Additional Resources:

NCBI RefSeq record:
XM_024446814.1
NBCI Gene record:
DNAAF5 (54919)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130727 GACTGATCTCATGCCGTATTA pLKO.1 2037 CDS 100% 13.200 18.480 N DNAAF5 n/a
2 TRCN0000184771 CGACTGATCTCATGCCGTATT pLKO.1 2036 CDS 100% 10.800 15.120 N DNAAF5 n/a
3 TRCN0000183303 GCCAAAGTGATTAGAAAGAAA pLKO.1 2844 3UTR 100% 5.625 3.938 N DNAAF5 n/a
4 TRCN0000129000 GCAGGAAAGTAAAGTTGCATT pLKO.1 3086 3UTR 100% 4.950 3.465 N DNAAF5 n/a
5 TRCN0000146272 CAGGATTTATCCTGAACTCTT pLKO.1 2110 CDS 100% 0.495 0.347 N DNAAF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.