Transcript: Human XM_024446849.1

PREDICTED: Homo sapiens extended synaptotagmin 2 (ESYT2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESYT2 (57488)
Length:
2084
CDS:
16..1848

Additional Resources:

NCBI RefSeq record:
XM_024446849.1
NBCI Gene record:
ESYT2 (57488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135582 GTGTATGAACATCCTGGACAA pLKO.1 1267 CDS 100% 4.050 5.670 N ESYT2 n/a
2 TRCN0000264260 AGGAAATTGTGAGATTGATTT pLKO_005 750 CDS 100% 13.200 9.240 N Esyt2 n/a
3 TRCN0000138341 CCTGTACCAAAGGGTGTTCTA pLKO.1 1072 CDS 100% 4.950 3.465 N ESYT2 n/a
4 TRCN0000135531 CTGAAAGAGCAGAATGGCTAA pLKO.1 506 CDS 100% 4.050 2.835 N ESYT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.