Transcript: Human XM_024447073.1

PREDICTED: Homo sapiens cell division cycle associated 2 (CDCA2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDCA2 (157313)
Length:
2712
CDS:
544..2538

Additional Resources:

NCBI RefSeq record:
XM_024447073.1
NBCI Gene record:
CDCA2 (157313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135053 CGGAAGTGTTTGATGAATCTT pLKO.1 1832 CDS 100% 5.625 7.875 N CDCA2 n/a
2 TRCN0000138065 GCCGTTCTCAGTTCTCCTAAT pLKO.1 2026 CDS 100% 10.800 8.640 N CDCA2 n/a
3 TRCN0000135143 CCGTTCTCAGTTCTCCTAATA pLKO.1 2027 CDS 100% 13.200 9.240 N CDCA2 n/a
4 TRCN0000365361 TGGGACTCATCCGAGCTTAAT pLKO_005 1692 CDS 100% 13.200 9.240 N CDCA2 n/a
5 TRCN0000138544 CCACAGTAACCGTAGAGCAAT pLKO.1 716 CDS 100% 4.950 3.465 N CDCA2 n/a
6 TRCN0000365429 GAACCACTTCAAGTATCATTT pLKO_005 2005 CDS 100% 13.200 7.920 N CDCA2 n/a
7 TRCN0000370535 TATGCATCAAGGCTATGATAA pLKO_005 2587 3UTR 100% 13.200 7.920 N CDCA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.