Transcript: Human XM_024447142.1

PREDICTED: Homo sapiens cleavage and polyadenylation specific factor 1 (CPSF1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPSF1 (29894)
Length:
4692
CDS:
430..4605

Additional Resources:

NCBI RefSeq record:
XM_024447142.1
NBCI Gene record:
CPSF1 (29894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000156 GACGGGTTTGTGCAGAATGTA pLKO.1 583 CDS 100% 5.625 7.875 N CPSF1 n/a
2 TRCN0000297335 GACGGGTTTGTGCAGAATGTA pLKO_005 583 CDS 100% 5.625 7.875 N CPSF1 n/a
3 TRCN0000000157 CCGCTACTTCGAGGATATTTA pLKO.1 2988 CDS 100% 15.000 10.500 N CPSF1 n/a
4 TRCN0000279870 CCGCTACTTCGAGGATATTTA pLKO_005 2988 CDS 100% 15.000 10.500 N CPSF1 n/a
5 TRCN0000000158 CACCTTCATCTCCTACGACAA pLKO.1 1176 CDS 100% 4.050 2.835 N CPSF1 n/a
6 TRCN0000279869 CACCTTCATCTCCTACGACAA pLKO_005 1176 CDS 100% 4.050 2.835 N CPSF1 n/a
7 TRCN0000000155 CACCACCAGCACACGGAACTA pLKO.1 4621 3UTR 100% 1.650 1.155 N CPSF1 n/a
8 TRCN0000279871 CACCACCAGCACACGGAACTA pLKO_005 4621 3UTR 100% 1.650 1.155 N CPSF1 n/a
9 TRCN0000000159 CCTCACAACATCAACTTCCGT pLKO.1 2881 CDS 100% 0.750 0.525 N CPSF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.