Transcript: Human XM_024447154.1

PREDICTED: Homo sapiens matrix metallopeptidase 16 (MMP16), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MMP16 (4325)
Length:
19061
CDS:
8575..9609

Additional Resources:

NCBI RefSeq record:
XM_024447154.1
NBCI Gene record:
MMP16 (4325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032834 CGCCACATACTGTACTGTAAA pLKO.1 9565 CDS 100% 13.200 18.480 N Mmp16 n/a
2 TRCN0000434551 CTGTACTGTAAACGCTCTATG pLKO_005 9574 CDS 100% 10.800 15.120 N MMP16 n/a
3 TRCN0000052249 CCTCCTAGTATCGATGCAGTT pLKO.1 8950 CDS 100% 4.050 3.240 N MMP16 n/a
4 TRCN0000433534 ATGGATACCCAATGCAAATTA pLKO_005 8909 CDS 100% 15.000 10.500 N MMP16 n/a
5 TRCN0000032838 CCACCAGATGATGTAGACATT pLKO.1 9418 CDS 100% 4.950 3.465 N Mmp16 n/a
6 TRCN0000052251 CCCACCAGATGATGTAGACAT pLKO.1 9417 CDS 100% 4.950 3.465 N MMP16 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5805 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.