Transcript: Human XM_024447501.1

PREDICTED: Homo sapiens GTPase activating protein and VPS9 domains 1 (GAPVD1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAPVD1 (26130)
Length:
6439
CDS:
2122..4176

Additional Resources:

NCBI RefSeq record:
XM_024447501.1
NBCI Gene record:
GAPVD1 (26130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220608 GCAAGCTACAACACAGGATAA pLKO.1 1609 5UTR 100% 10.800 15.120 N GAPVD1 n/a
2 TRCN0000424059 GTGCAACCTCTGAGGATATTC pLKO_005 2027 5UTR 100% 13.200 10.560 N GAPVD1 n/a
3 TRCN0000419221 AGTGACTTTGACCCTAATATT pLKO_005 1739 5UTR 100% 15.000 10.500 N GAPVD1 n/a
4 TRCN0000010987 CCCTTGTTGTTGGGAGCATTT pLKO.1 5521 3UTR 100% 10.800 7.560 N GAPVD1 n/a
5 TRCN0000220605 GCCACTTTACATGAGCCAATT pLKO.1 347 5UTR 100% 10.800 7.560 N GAPVD1 n/a
6 TRCN0000220607 CGCAGGATTCAGCTTTCTCTT pLKO.1 3068 CDS 100% 4.950 3.465 N GAPVD1 n/a
7 TRCN0000220606 GCAGTTTCTTTATGGTGCAAT pLKO.1 3606 CDS 100% 4.950 3.465 N GAPVD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.