Transcript: Human XM_024447628.1

PREDICTED: Homo sapiens AT-rich interaction domain 4B (ARID4B), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARID4B (51742)
Length:
4086
CDS:
464..3631

Additional Resources:

NCBI RefSeq record:
XM_024447628.1
NBCI Gene record:
ARID4B (51742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236101 AGATAGAGGTACACCTATTAA pLKO_005 1426 CDS 100% 15.000 21.000 N ARID4B n/a
2 TRCN0000146353 CCTATTAACAAACGACCTGTA pLKO.1 1439 CDS 100% 4.050 5.670 N ARID4B n/a
3 TRCN0000363511 GGAATCTAAGATTGATCATTT pLKO_005 2407 CDS 100% 13.200 10.560 N ARID4B n/a
4 TRCN0000236103 TGTACTTGGATATCGAAATTT pLKO_005 1456 CDS 100% 15.000 10.500 N ARID4B n/a
5 TRCN0000363428 TAGATGAATCCCTCAACATAA pLKO_005 1992 CDS 100% 13.200 9.240 N ARID4B n/a
6 TRCN0000236099 TATCCGAAGATACTGATTATG pLKO_005 2571 CDS 100% 13.200 9.240 N ARID4B n/a
7 TRCN0000146564 CCATAAAGCAACAGTGGTAAA pLKO.1 3724 3UTR 100% 10.800 7.560 N ARID4B n/a
8 TRCN0000150229 GTAGATGAATCCCTCAACATA pLKO.1 1991 CDS 100% 5.625 3.938 N ARID4B n/a
9 TRCN0000147109 CTAGGCAAAGTTGTATGTGTA pLKO.1 980 CDS 100% 4.950 3.465 N ARID4B n/a
10 TRCN0000147816 GCAATACAGAAGAGTGTCTAA pLKO.1 2688 CDS 100% 4.950 3.465 N ARID4B n/a
11 TRCN0000149755 GCACTGATGTGAGTGCTAAAT pLKO.1 501 CDS 100% 1.320 0.924 N ARID4B n/a
12 TRCN0000358800 ACTCTGATACTGCTCATATTA pLKO_005 2271 CDS 100% 15.000 9.000 N ARID4B n/a
13 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1299 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.