Transcript: Human XM_024447684.1

PREDICTED: Homo sapiens transient receptor potential cation channel subfamily M member 3 (TRPM3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPM3 (80036)
Length:
9874
CDS:
782..3508

Additional Resources:

NCBI RefSeq record:
XM_024447684.1
NBCI Gene record:
TRPM3 (80036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415993 GCGATGCCTTGAAGGATCATG pLKO_005 14 5UTR 100% 4.950 3.960 N TRPM3 n/a
2 TRCN0000125532 CCTCAAGGTAATTCTGGGAAT pLKO.1 1846 CDS 100% 4.050 3.240 N Trpm3 n/a
3 TRCN0000430388 GCATGCATTCCCACTTCATTC pLKO_005 179 5UTR 100% 10.800 7.560 N TRPM3 n/a
4 TRCN0000419737 TTCCTGTGGTGGCACTCATAG pLKO_005 308 5UTR 100% 10.800 7.560 N TRPM3 n/a
5 TRCN0000044259 CCCAATGTGATCTCGATTGTT pLKO.1 340 5UTR 100% 5.625 3.938 N TRPM3 n/a
6 TRCN0000044258 CGAGGAAAGATATGCACCATA pLKO.1 46 5UTR 100% 4.950 3.465 N TRPM3 n/a
7 TRCN0000044260 GCATATTTCACTCCAGAAGAT pLKO.1 264 5UTR 100% 4.950 3.465 N TRPM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.