Transcript: Human XM_024447994.1

PREDICTED: Homo sapiens solute carrier family 16 member 12 (SLC16A12), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC16A12 (387700)
Length:
4517
CDS:
393..1730

Additional Resources:

NCBI RefSeq record:
XM_024447994.1
NBCI Gene record:
SLC16A12 (387700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431662 TTGGCTTTGCTAGACTTATAA pLKO_005 4495 3UTR 100% 15.000 21.000 N SLC16A12 n/a
2 TRCN0000418883 AGTGTTGTCAGTAACCATTTA pLKO_005 708 CDS 100% 13.200 9.240 N SLC16A12 n/a
3 TRCN0000043482 CCTGTGGTTCAGCTCCTTATT pLKO.1 966 CDS 100% 13.200 9.240 N SLC16A12 n/a
4 TRCN0000424831 GATGAGGCCAATTACTCTTAA pLKO_005 1061 CDS 100% 13.200 9.240 N SLC16A12 n/a
5 TRCN0000043481 GCTTGCATCTACTGGACTCAT pLKO.1 761 CDS 100% 4.950 3.465 N SLC16A12 n/a
6 TRCN0000043479 CCAGTATGTTTGCTACCTCTT pLKO.1 1436 CDS 100% 4.050 2.835 N SLC16A12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.