Transcript: Human XM_024448088.1

PREDICTED: Homo sapiens Rho GTPase activating protein 21 (ARHGAP21), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP21 (57584)
Length:
6843
CDS:
297..6041

Additional Resources:

NCBI RefSeq record:
XM_024448088.1
NBCI Gene record:
ARHGAP21 (57584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154948 GCACATAGGTTGTCGGACAAT pLKO.1 1265 CDS 100% 4.950 6.930 N ARHGAP21 n/a
2 TRCN0000153502 CCTGACCAAATAAACGGAGAA pLKO.1 5916 CDS 100% 4.050 5.670 N ARHGAP21 n/a
3 TRCN0000150338 CTTGTGAAAGTCCGAAGTAAT pLKO.1 1914 CDS 100% 13.200 9.240 N ARHGAP21 n/a
4 TRCN0000156175 CCTCACAACTTCAGCTCCATT pLKO.1 2696 CDS 100% 4.950 3.465 N ARHGAP21 n/a
5 TRCN0000151310 GATACTAAAGAGGAGTCCAAA pLKO.1 4521 CDS 100% 4.950 3.465 N ARHGAP21 n/a
6 TRCN0000150898 GCAAGGTATTTGTTGCAACTT pLKO.1 6265 3UTR 100% 4.950 3.465 N ARHGAP21 n/a
7 TRCN0000154410 GCAGAGTTTCATCCCTGTCTT pLKO.1 6018 CDS 100% 4.950 3.465 N ARHGAP21 n/a
8 TRCN0000154949 GCATCTCAAAGCACGACAGAT pLKO.1 1314 CDS 100% 4.950 3.465 N ARHGAP21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.